For deer sampled in GTA, spatial locations were recorded to the nearest 0·1 km. Between December 2007 and January 2008, 50 free-ranging deer were harvested by United States Department of Agriculture Wildlife Services personnel through deer management programmes initiated by the DuPage County Forest Preserve. For deer sampled in DuP, spatial locations were recorded to the nearest township/range/section (TRS). During the autumn hunting seasons between 2005 and 2007, 324 free-ranging deer were harvested at University of Illinois Robert Allerton Park (RAP) through their Deer Management and Research Programme. For deer sampled in RAP, spatial locations were recorded to the nearest kilometre. Genomic DNA was extracted from ethanol-preserved muscle samples using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA). LBH589 ic50 Individuals were genotyped using microsatellite primers developed for white-tailed deer (Anderson et al. 2002; Blanchong 2003). This panel included markers BM1225, BM4107, CSN3, (Bishop et al. 1994), IGF-1 (Kirkpatrick 1992), OBCAM (Fries, Eggen & Womack 1993), OarFcb304 (Buchanan et al. 1993), RT20, RT23, RT27 (Wilson et al. 1997), and Srcrsp-10 (Bhebhe et al. 1994). Mutations in microsatellite flanking regions required the re-design of primers CSN3 (reverse primer = TAGCTCATAATGTAAACCACTTT) and RT20 (forward primer = TGGAAGATTTCAGAAATGAT). Forward primers were labelled with fluorescent dyes (NED, HEX, FAM) with fragments separated on an ABI 3730XL capillary sequencer (Applied Biosystems, Foster City, CA, USA) and visualized with genemapper (v. 4.0; Applied Biosystems). We used micro-checker (v. 2.2.3; Van Oosterhout et al. 2004) to evaluate genotyping errors using expected allele frequencies derived under Hardy–Weinberg equilibrium (HWE). Expected heterozygosity was calculated for each locus in each of the four sampling areas (with all 13 NIL study sites pooled) using arlequin version 3.1 (Excoffier, Laval & Schneider 2005). Allelic diversity and the number of rare alleles per locus (alleles exclusive to one sampling area) were determined with deviations from HWE examined using FIS (inbreeding coefficient) by locus and overall with genepop (v. 4.0; Rousset 2008). We computed FST values among study sites with arlequin (Excoffier, Laval & Schneider 2005) and used Mantel tests to examine correlations with geographic distance (in km) using Isolation by Distance Web Service (ibdws v. 3.16; Jensen, Bohonak & Kelley 2005), with significance based on 1000 random permutations. Isolation by distance (IBD) was examined at two spatial scales: distances <100 km including all 13 NIL study sites and distances <300 km encompassing NIL, DuP, GTA, and RAP study sites. When performing tests for IBD, we analysed both genders combined, then each separately. We tested for sex-biased dispersal using fstat (v. 2.9.3.